Notice: The contact form functionality has been restored. Apologies for any inconvenience.

EST details — SGN-E286933

Search information 
Request: 286933Match: SGN-E286933
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C78681Clone name: cLES-6-G9
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C179059 is on microarray TOM1: SGN-S1-1-8.1.2.2
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179059 [TUS-30-M9] Trace: SGN-T184461 EST: SGN-E371847 Direction: 3' Facility: INRA
Clone: SGN-C179059 [TUS-30-M9] Trace: SGN-T184462 EST: SGN-E371848 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E286933Length: 311 bp (836 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E286933 [] (trimmed) GCCACCTTCTCTGTCACTAAAGCTGGTCGAGGGCTCCTCCAGGCAGTCAGCTTTCCATGCTAATCCGTCATCTGGTAGCTCAGGCATGAACTCTA
GCCACAATCCAATCCATGCAGTTTAGAAGGGTGCATTCACATGATATGTTTCCTGTTAATATATGAAAATGTTCTCTAGTTTGGTTGGTTAGTTA
TAGTTCTATTTGTTGGGTCGATCTTAATAAGACTATTTAGGTGTTAACTGCTTAGTTGGCAATACTCATACCTTTGTAGGCACTCTTGTTTTGAA
GTATTTAAGTTGTTGACTTTGAGTCG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E286933] SGN-U582548 Tomato 200607 Build 2 27 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T98385 [Download] [View] Facility Assigned ID: TPSAU41TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.951 Expected Error Rate: 0.0023 Quality Trim Threshold: 12.5