Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E286989

Search information 
Request: 286989Match: SGN-E286989
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C78757Clone name: cLES-6-K4
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C185475 is on microarray TOM1: SGN-S1-1-8.4.9.7
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185475 [TUS-47-H17] Trace: SGN-T192341 EST: SGN-E391015 Direction: 5' Facility: INRA
Clone: SGN-C185475 [TUS-47-H17] Trace: SGN-T192617 EST: SGN-E391291 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E286989Length: 548 bp (902 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E286989 [] (trimmed) GAAACCAACATTTCCATATGCCATTATAGAGTAAACCATCTTAAAATAGAGCAGCAGACAATAGGCTACTCAGTCATCCAAATATATGTGAATCA
CTGGGCTAGTAATATACATATTTCCATCTACTCTATGAATCATTGTTCAATACATGTAAATGGGTTCTATTCTATAATCCAAATGAGAACCTCCA
CCCAAAAATTGAGAAAAAAGGAAATATGAATTTGGTACAAGGGCCTTGAAAAAAAACAACGCAGACGCCTGGAAGATTATACCAAGTCTGACGTA
CAACGCACCTTCAAAGCAGATGTCCAGAATTCATTACTTGGGACCAAATGATATACTGTATCCTAACCAAGAACCTCCTTGATCTGTTTCTTTTG
GTCCTCCGTCAATGACGTGGGGAAAAGAACCTCAAATTTAACATATAAATCACCCTTCTTGTTACTGTAATGTAGCGGCATCCCTTCACCTTTAA
ACTTCCTCACTTCTTTAGGTTTAGTGATTCCCTTTGAACTAATGTCCACCAGATGATCATCGAGATGTTTGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E286989] SGN-U569510 Tomato 200607 Build 2 28 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T98441 [Download] [View] Facility Assigned ID: TPSAV62THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.957 Expected Error Rate: 0.0080 Quality Trim Threshold: 14.5