EST details — SGN-E287076

Search information 
Request: 287076Match: SGN-E287076
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C78825Clone name: cLES-6-N8
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C179109 is on microarray TOM1: SGN-S1-1-6.3.2.2
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179109 [TUS-30-O11] Trace: SGN-T184475 EST: SGN-E371861 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E287076Length: 377 bp (870 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E287076 [] (trimmed) ATTATTGGCCTGCATCTGAAGATACAACAGTGGCTCTCTGGGAACTTTATCCCCCTAGAACATGACATTGTATCGTTGTTGATCCTCGTGGATTG
TTTGTAATGAATGGGTTAACGTCTGAAGTTTTGCAGCGCGAGAGTGATCCCCAGATGAGCATATGGAGTTGCTGGAAGATATTACTGATCATTAG
AAAGAGAAGAGGACCTTAGGCTATTTTTGGCAAATAGACACTTTGGTCTGGCCTTTTCCCCGACCCTGCATATAGCGAGAGCTTAGTGTATTGAA
CTATATCACTTTTAAAGTTGTTCGAAAGAAACATAGTTGTGAAAATACTAAAAAAGAACTCTACTTGTAACTCTTAAACAAGAAGAGTTGTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E287076] SGN-U576028 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T98528 [Download] [View] Facility Assigned ID: TPSAX76TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.953 Expected Error Rate: 0.0078 Quality Trim Threshold: 12.5