EST details — SGN-E287113

Search information 
Request: 287113Match: SGN-E287113
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C78831Clone name: cLES-6-O15
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C179110 is on microarray TOM1: SGN-S1-1-5.3.2.2
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E287113Length: 204 bp (1170 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E287113 [] (trimmed) TTCTATGATTCTTCCTTCTCACCATATAATTGGAAAAAAAAATGTCAATCCTTTCTCTCTCCTTTTCTCCATTTGCAAATTCATCTCTCTCTCAT
CTCAGGTCCCATGCTCCCTCCCGGGTCCAATCACTCCATCCTTCTTCATCCATGACCCTCCTCAAACCTCTCCACCACCATCTCCGTCGACGTCT
CTTCATCTCCGCCG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E287113] SGN-U580858 Tomato 200607 Build 2 39 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T98565 [Download] [View] Facility Assigned ID: TPSAU92TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.924 Expected Error Rate: 0.0313 Quality Trim Threshold: 14.5