EST details — SGN-E287228

Search information 
Request: 287228Match: SGN-E287228
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C78849Clone name: cLES-6-P18
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C185481 is on microarray TOM1: SGN-S1-1-2.4.9.7
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185481 [TUS-47-H23] Trace: SGN-T197668 EST: SGN-E396342 Direction: 5' Facility: INRA
Clone: SGN-C185481 [TUS-47-H23] Trace: SGN-T197769 EST: SGN-E396443 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E287228Length: 504 bp (863 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E287228 [] (trimmed) AAAAAAAAAAAAAACATTTTATAGCTAAGTAAGTAAACGCAATGGCTTCCTCAATTGTCTCATCGGCAGCCGCTGCTACCCGTAGCAATGGTGGA
CGCGTTAGATGCATGCAGGTGTGGCCACCAATCAACATGAAGAAATACGAGACATTGTCATACCTTCCTGACTTGTCCGATGAGCAATTGCTTAG
CGAAATTGAGTATCTTTTGAAAAATGGATGGGTTCCTTGCTTGGAATTCGAGACTGAGCGCGGATTTGTGTACCGAGAGAACAACAGTTCCCCTG
GATACTACGATGGTAGATACTGGACCATGTGGAAGTTACCTATGTTTGGGTGCACTGATGCAACACAGGTGTTGGCTGAGGTTCAAGAGGCGAAG
AAGGCGTACCCACAAGCCTGGGTTCGTATTATCGGATTCGACAACGTTCGTCAAGTCCAGTGCATCAGCTTCATTGCCTACAAGCCAGAAGGATT
CTAAATTTCCAAACATATAATCAAAATGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E287228] SGN-U578246 Tomato 200607 Build 2 245 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T98680 [Download] [View] Facility Assigned ID: TPSAX93TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.982 Expected Error Rate: 0.0091 Quality Trim Threshold: 14.5