EST details — SGN-E287524

Search information 
Request: 287524Match: SGN-E287524
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C79505Clone name: cLES-9-D3
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C190318 [TUS-60-B12] Trace: SGN-T340901 EST: SGN-E540026 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C190318 [TUS-60-B12] Trace: SGN-T340904 EST: SGN-E540029 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E287524Length: 433 bp (649 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E287524 [] (trimmed) CCAATACCAATAGAGAAAAGTCTCTGTAGAAAAGAGCTTTGACTCTCTCTTCCAATGGTGAATTTAGTTTTCACACTTTCATGAACAACTTTCTT
CTCATATTCACATTCTTCTCTTAATTCCATAACTACCCTCCAATTCTTATCTCCAACAACAACAAAAAGAGGCAACATTTTGCTTTTCTGCAGGT
TTTCTTTTTCTACATTTCATTGCTGTTTAATCTTGGTTTTTAATGTTGTTTCTGTATGTTGGTATCATTTTTTCTTCTTGTTTTTGATTTTATAT
GTTGGGGTTTTGAAAAAGATAAGAAATTTATAAGAATCTTGAAATATGGGTGTTCATATTCTTGAAGATCTCTTAAAAAAGCATGCTTTTTGGGT
TTTCTTTTTGTTTTGNTTCAAGAAAGTTAGAATCTGAATGAATATTTGAATAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E287524] SGN-U572211 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T99343 [Download] [View] Facility Assigned ID: TPSBI14TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.898 Expected Error Rate: 0.0117 Quality Trim Threshold: 14.5