EST details — SGN-E287627

Search information 
Request: 287627Match: SGN-E287627
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C79616Clone name: cLES-9-I9
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C190330 [TUS-60-B24] Trace: SGN-T340925 EST: SGN-E540050 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E287627Length: 418 bp (642 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E287627 [] (trimmed) GAAAAATCTCAGCTAACATTAATCAATTGTATACTACAATACTACCAATATTTCTTGTTACAGCAGAGCAGCTACCAGTATCTTGCTAATTCAAA
ATCTGTAACATTATTTCTGTAAGGAATGTTTAGAGTAGCCTTTCCGTGTCATGCTAATTACAAAAATCAGATCAAGGTAAAAATTAAAAGAAAGG
TATACAAAGATAACAACAATAGGTACTCTGTAGTACATATGTGATCTACTACTGGCCGAGGCAGATGCAGTTTCATGCTCCCTCAGGCAATAGTC
ACCGACCAGTGGAGTGAGCAAAAAAGCAGCAAAAATAAGCAGAGTGACAATTGCCCTATGAAAACTCGCTTTGTGACAATCTTTATCTTGATTGT
TCATTGTTGCTGCCTTTCCTGCCTATGAACACACTCCG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E287627] SGN-U572158 Tomato 200607 Build 2 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T99446 [Download] [View] Facility Assigned ID: TPSBG53TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.938 Expected Error Rate: 0.0021 Quality Trim Threshold: 14.5