EST details — SGN-E287675

Search information 
Request: 287675Match: SGN-E287675
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C79720Clone name: cLES-9-O10
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C190344 [TUS-60-C14] Trace: SGN-T340946 EST: SGN-E540071 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C190344 [TUS-60-C14] Trace: SGN-T340949 EST: SGN-E540074 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E287675Length: 421 bp (670 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E287675 [] (trimmed) GAAGTTGGAGTGGACATTGAGCTCATCACAAAGCAAAGTTGAGCTGGTTACATAGCATGGGTCGCAATTTAGGACATTTTTTTTCCAGAGTGAAG
ATGCACGATGTGGATAGTTCCTTCGGCCGCTAGTATGTTTGTTGCTGTAGGAGGGTTACCTTTTGTCTACCTTCGAGTTTATACACGAAACTAAA
CAATGTGACGACTTGTCTCTGGAGACCAGATCTTTTCAGTTTTGTGGTCGACAACAATGGTGATACAAGTATATCAAAGGGGAAGGAAAAAAAGG
ATGAATGTGATGAGAAAGGGAGTTAAAACTTATAAAAGCACTTAAGATTGGCAATGAATTCTAAAGCAGTGTGTCAAAAATTAAAGAAATACAGA
AACCACTTAAGTGACACGGATGGTATATCCTCTCTATTCCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E287675] SGN-U573868 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T99494 [Download] [View] Facility Assigned ID: TPSBH89TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.958 Expected Error Rate: 0.0121 Quality Trim Threshold: 12.5