EST details — SGN-E287839

Search information 
Request: 287839Match: SGN-E287839
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C76750Clone name: cLES-19-A15
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E287839Length: 441 bp (904 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E287839 [] (trimmed) TTTCTCTACAAATTAGCAAATCTAAGCGAAACCCAGAAGGGATTTTAAGCTCAGAAAATGGAATCAGCTGCTAGAAGAAGTGGTGGTGGTGTTCT
TGAAGGATTTTACAGGCTGGTTATGCGCCGTACCCCTGTCTATGTTACCTTTGTCATCGCCGGCGCTTTGCTCGGCGAACGGGCAGTGGATTATG
GCGTTAAAACTCTCTGGGAGAAGAACAATGTTGGGAAGCGTTACGAGGATATTTCAGTTCTTGGACAGCGGCCTGTTGATGAATAAATTTTCAGT
AATGAAAGTTTATTTGAGACGAGACAAAGTACTTGTTATCGATATTTCAATAATTGTTTTGCTAATCGCCATTGCTGGCTTTCTTTTATATTTTT
GCTGTAGTTGTGAAGGAAATTCATTGAATGAAATATGATACCAAATTGAAATTTTTGTCAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E287839] SGN-U570518 Tomato 200607 Build 2 16 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T101896 [Download] [View] Facility Assigned ID: TPSCU08TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.956 Expected Error Rate: 0.0222 Quality Trim Threshold: 12.5