EST details — SGN-E287841

Search information 
Request: 287841Match: SGN-E287841
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C76752Clone name: cLES-19-A19
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C185573 is on microarray TOM1: SGN-S1-1-6.4.9.8
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185573 [TUS-47-L19] Trace: SGN-T192630 EST: SGN-E391304 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E287841Length: 538 bp (883 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E287841 [] (trimmed) CAGGCCGCCCACTCAATCTTCACCACAACCAGCACTACCAATTCTTTCTTATACCCAATTTCTTCTTCTTCTTCTTCCCCTAACATTAACTCTTC
TTTCCATGGTGTTTCACTTAATGTTAAGTCAAAATTTGGCCAATCTTTGACCCTTTATGCTGTCACTACCCCTAAACCCCTTACTGTTTTTGCTG
CTACTAAGAAAGCTGTTGCTGTCCTTAAGGGCAACTCTAATGCTGAGGGGGTTGTCACTCTATCTCAAGATGATGATGGTCCAACTACGGATAAT
GTTCGTATAACTGGACTTGCTCCTGGACTTCACGGGTTTCATTTACATGAATATGGTGACACTACAAACGGATGTATGTCTACAGGAGCCCATTT
TAATCCGAATAAATTGACACATGGAGCTCCTGGAGATGAAATCCGTCATGCGGGTGACCTGTGAAACATAGTGGCCAATGCCGATGGCGTGGCTG
AAGTGACACTTGTAGATAATCAGATACCATTGACCGGTCCAAACTCAGTTGTTGGACGAGCAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E287841] SGN-U583863 Tomato 200607 Build 2 49 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T101898 [Download] [View] Facility Assigned ID: TPSCU10TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.977 Expected Error Rate: 0.0206 Quality Trim Threshold: 14.5