EST details — SGN-E288090

Search information 
Request: 288090Match: SGN-E288090
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C78947Clone name: cLES-7-E5
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C190247 [TUS-59-O13] Trace: SGN-T340782 EST: SGN-E539907 Direction: 5' Facility: INRA (MWG)
Clone: SGN-C190247 [TUS-59-O13] Trace: SGN-T349172 EST: SGN-E548297 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E288090Length: 468 bp (866 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E288090 [] (trimmed) TTGCTGACTATGCATCAGTTGAGGAAAAAACTGAAGAGGCAGAAGTTGAAGAGATATCTGAAGAATCATCTATTGAAGAGAAATCTGAAGAATCA
AGGGTTTTGGAGAAACCAGAAGAACCATCGGTTGAGAAAATACCTGAAAAACCGACAATCGAAGAGAAACCTGAAACATCAACCGTGGGAGAAAA
GTTTGAAGAACCATCAGTTGAGGAGACGATCAAAGAACCAAAAATTGAGGAGAAACCTGAAAAACAAGTAACTGAAGAAACACCCAAGGAACTAG
CGTTAGAAGAGATACATAAAGAACCAGCAATGAAAGAGGAGAAACCTGAAAAGGTAACTCTTTTGGAAAAGAATATGCTAATTGTGGACTCAAAC
ACCAAAACTGGCAGTGAAATTCCATGCAATACCAATAATGATGATGCTCACTCCCCAGACATTGAGGAAAATCCTGAAGAATCGGCAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E288090] SGN-U563192 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T98846 [Download] [View] Facility Assigned ID: TPSAY27TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.911 Expected Error Rate: 0.0194 Quality Trim Threshold: 14.5