Notice: After server upgrades, BLAST should be back now. Apologies for any inconvenience.

EST details — SGN-E288101

Search information 
Request: 288101Match: SGN-E288101
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C79024Clone name: cLES-7-I5
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C190255 [TUS-59-O21] Trace: SGN-T340793 EST: SGN-E539918 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C190255 [TUS-59-O21] Trace: SGN-T340796 EST: SGN-E539921 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E288101Length: 611 bp (859 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E288101 [] (trimmed) CAGATTAGTCCATCACCATGGCTTTCCAAGTAGAACCAAAACTTCCCATAATTGAGTTCACAAATGAGACCTTGAGGAGTGGCACAACCTCATGG
TTATCGACGTCTCGAGAAATCCGATGCGCGTTGGAAGAGTACGGTTGCTTTGCGGCAGTGTACAAGAAAGTCATGCCGGAGCTAAGGGAAGCCAT
GTTTGATCATTGCAAGGAGTTGTTTAAACTTCCCTTAGAAACTAAACTCAAAAATAATAGTGATATTTATGGTTTTGGTTATAGTGGGAAATTTA
GCACTATGCCTCTAGCTGAATTTTTTGGTATCGTCAATGGAGAAACTATTGATGCAACTAAGGATTTTGCTAACAAGATGTGGCCAAATGACAAC
GTTCATAAATACTGTGAAGAATCGATTTCATATTCAAAATTAATTGTTGAACTAGACGATACGATTATTCGTATGATATTGGAGTGTTATGGCAT
AGAGAAACATTATGAAGCTCTAAAAAATTCATGTATGTATTTGATGAGATTAATTAAATATCGAAGCCCAAAAAATGATGAAAAAAGTATAGGTC
ATTTACCTCATAGAGATAAATCATTTATGGGAATTATTGAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E288101] SGN-U572959 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T98857 [Download] [View] Facility Assigned ID: TPSAY51TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.957 Expected Error Rate: 0.0064 Quality Trim Threshold: 14.5