EST details — SGN-E288286

Search information 
Request: 288286Match: SGN-E288286
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C76031Clone name: cLES-16-J21
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C190538 [TUS-60-K16] Trace: SGN-T341279 EST: SGN-E540404 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C190538 [TUS-60-K16] Trace: SGN-T341282 EST: SGN-E540407 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E288286Length: 450 bp (940 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E288286 [] (trimmed) AGAGAGGGCAAAAATATACACTCCATTAAATTTTTGGTATATTTAAACAGAAAAATATCATCAAAATACATTGTAAAATGTAGAAGATAATATAA
GTAAATTAATCTGTCAGCCTCCTTTTCTACCTGCCATTTTTATTCACGGAGAGCTGACCGGAAAGATTATGCCTAAACCTTTTACAACGACGGGA
ACTAGGCGCTATACACAGTTAACTATATGAAATATTACAAGAAACAACTTAAAATAGTTTTTGTATACCCTAACTATATAGTTTCCTACCCTCAA
TCTAACTGCAAACTATTACATTCATAAGTGATTCATTATTTTTGGCTCTATGAACGTTTTCACAACATTGGAATACATCATCGTACTCACAATTG
GTGGGTGTATTCATTTGGTTCGGCTTCCCCCTCCTCATCCATCTTAATTGAAAGCAGCTGCCACTTGCCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E288286] SGN-U565869 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T101012 [Download] [View] Facility Assigned ID: TPSCK59TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.932 Expected Error Rate: 0.0147 Quality Trim Threshold: 14.5