EST details — SGN-E288303

Search information 
Request: 288303Match: SGN-E288303
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C76121Clone name: cLES-16-P3
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C185549 is on microarray TOM1: SGN-S1-1-6.3.9.8
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185549 [TUS-47-K19] Trace: SGN-T192086 EST: SGN-E390760 Direction: 5' Facility: INRA
Clone: SGN-C185549 [TUS-47-K19] Trace: SGN-T192596 EST: SGN-E391270 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E288303Length: 525 bp (955 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E288303 [] (trimmed) CAGCATTTCAAATATTCTTTACTCCTAACCAAAAATTTAATTCCCCAGCAAACAAACAATCAAAATGAAGCAAAAGGTTGTTATTAGACTATCTT
TAAATGGAAACGGTCAGAAAGATCGAACCAAGGCCTTCAAAATTGCTGTTTCTCAATCAGGCGTAGAATCAGCAGCTATAACAGGAGACGGAAAG
AATCAACTCGAAGTTGTGGGAGAAGTAGACGCTGCGACTCTAACGAGCTTATTGAGGAAGAATTTGGGCCAGGCGGACTTGGTTAGCGTTGGCCC
GGCTGGTGGCGATAAAAAACCCGCAGCTCCAGCTCCAGCTTCAGCTGCAGCTGCAGCTGCGGTGGTACAATCGCAGCCCGACTCGTATTACTATG
TTTATGCGCCTTATCAATACCCTGTTTACCAAGTTACAGATTCTTATGGTCAATCGAATTGTTCCATTATGTGAAGAACAGGGAGATCCAAGATA
TAATAAAATTGTATTCACCGCCGAATATTTATTGATATGTTAGATAGATA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E288303] SGN-U584433 Tomato 200607 Build 2 16 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T101029 [Download] [View] Facility Assigned ID: TPSCK86TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0232 Quality Trim Threshold: 12.5