EST details — SGN-E289352

Search information 
Request: 289352Match: SGN-E289352
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C76665Clone name: cLES-18-L8
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C179199 is on microarray TOM1: SGN-S1-1-4.3.2.7
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179199 [TUS-31-C5] Trace: SGN-T185095 EST: SGN-E372638 Direction: 3' Facility: INRA
Clone: SGN-C179199 [TUS-31-C5] Trace: SGN-T185096 EST: SGN-E372639 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E289352Length: 422 bp (984 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E289352 [] (trimmed) TGTATTTGTTGACGAGTTTAGCTGCATAGGCTGCAAAAATTGTGCCAATGTTTGCTCAAAAGTGTTTGGGATTGAGGAAGACTTTGGAAGAGCTA
GAGTTTACGATCAATGTGGACACCCTGATTTAATTCAACAAGCTATAGATAGCTGCCCAGTGGATTGCATACATTGGACTTCTGCTGCACAGCTG
TCTTTGCTTGAGGATGAAATGCGAAGAATAGAAAGAGTAAACGTTGCCTTGATGCTATCAGGAATGGGCAGTGGAGCCATGGATGTATTCAGAAT
GGCGAGCACGCGGTGGGAAAAACGACAATCTAAAGTTCTGGAACAAGCTAAAGTCAGAATGATGAAGAAGAAAAATTCTGAGAAAACTGAATCAT
ACTGGGATAACCTATGGGGCGATCGTNAAGACTACACAAAGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E289352] SGN-U566991 Tomato 200607 Build 2 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T101794 [Download] [View] Facility Assigned ID: TPSCT64TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0101 Quality Trim Threshold: 14.5