EST details — SGN-E289526

Search information 
Request: 289526Match: SGN-E289526
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C85575Clone name: cLET-3-F21
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E289526Length: 373 bp (801 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E289526 [] (trimmed) GAAAGTTGTGGATGTCTCGAATAATGATTTGTGTGGAACAATTCCTACTTCTGGTCCATTTGAGCATATTCCTCTAAACAATTTCGAGCACAATC
CTCGACTTGAAGGTCCGGAGTTGTTGGGACTCGCTACCTACGACACCAACTGCTCTTAGAAGCTTGATGAATAGCTTCAGAAGAAGCGCCACTTT
AGTGGACGTTTAACAAATTCCCCTGAACCTTGTTTATTGGTGTACTTACAGTGTGTCCAAAGTTGTAACTCTAAGCAAAAATATGGTGTATGTAG
GTTATTACTGAGTTAAAGTATGTGTGTAAAACAATCTCTATACTGCTACCAACTGTTGATGTATTTCATATTTTAATGTCTAGTGAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E289526] SGN-U583216 Tomato 200607 Build 2 165 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T103197 [Download] [View] Facility Assigned ID: TMEAK35TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0245 Quality Trim Threshold: 12.5