Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E289615

Search information 
Request: 289615Match: SGN-E289615
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C87358Clone name: cLET-4-D21
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C190659 [TUS-60-P17] Trace: SGN-T341487 EST: SGN-E540612 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C190659 [TUS-60-P17] Trace: SGN-T349289 EST: SGN-E548414 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E289615Length: 317 bp (886 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E289615 [] (trimmed) GTATTGTAAAGGTCATCCAGATAATAGTCGCTTAATTGAAATTGATGAAAATGAGAGTGGGGAGGTTGTGCTTCCTGGTGGAATTTCAATACCTA
ATGTGTCAAAATCTATCAAATGTGATAAAGGAGAACACACACGGGTTGGCTCTGATGTTCTTTCTTTCCAGCAGATGTCAGAGCAGTTCAATCAG
GAAGTATCCGTGAATGGTAAAATTCCTTCGGCGCTCTTCAATACTATGTTCGAGTTTTCTGGTTCTTGGCAGAACGATGCTGCATACACTAAAAC
CCTTGCTTTTGATGGTGTGTTCATCACGTTGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E289615] SGN-U585158 Tomato 200607 Build 2 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T103286 [Download] [View] Facility Assigned ID: TMEAO23TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0144 Quality Trim Threshold: 14.5