Notice: After server upgrades, BLAST should be back now. Apologies for any inconvenience.

EST details — SGN-E289713

Search information 
Request: 289713Match: SGN-E289713
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C87352Clone name: cLET-4-D15
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
This clone has been mapped as cLET-4-D15.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E289713Length: 303 bp (905 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E289713 [] (trimmed) CAAAACCCGAAAAGCTTGACTCACCAGTTGTTGATAATGGAGACAACTGGAGTGTTGGGCAGAGGCAGCTTCTTTGCTTAGGAAGAGTGATGCTA
AAACGAAGCAGACTTCTATTTATGGACGAGGCAACCGCCTCTGTTGATTCACAGACAGATGCTGTGATTCAGAAAATCATCCGCGAGGACTTCAA
CGCCTGTACTATAATCAGCATTGCCCACAGAATACCAACAGTCATGGACTGTGATAGAGTTCTTGTTGTAGATGCAGGAATAGCAAAAGAGTTTG
ACAAACCATCTCATTTGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E289713] SGN-U565313 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T103384 [Download] [View] Facility Assigned ID: TMEAO20TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0226 Quality Trim Threshold: 12.5