EST details — SGN-E290170

Search information 
Request: 290170Match: SGN-E290170
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C87642Clone name: cLET-5-G11
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C190687 [TUS-61-A21] Trace: SGN-T341535 EST: SGN-E540660 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C190687 [TUS-61-A21] Trace: SGN-T341538 EST: SGN-E540663 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E290170Length: 538 bp (848 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E290170 [] (trimmed) GAAAAGCGAGTCAGATGCAGATGATGAAGAAGCAAGGAGTGTGCAACATCATTTAGTGAGAGCATTGGAGAGGAATGGGAAACTGGTGAGCTCCC
AACTTGAAGCTCAGAATATGCAGTTTGAACAGGATAGGGAGCAAAGGAAGGACCATGTTGATAACTTAGTAGCAGTACTTACGAAGCTTGCAGAT
GCTTTGGGAAGAATTGCAGATAAGTTCTAGGGCTGTTGAGTTAATTACAATGCATATCATGTTGTCTTCATACACAAGGCTGAAGTTCAGTTTTG
GTTTGTTAATTAGTAGTTGGAGATGACATGTTCTTCTCAGGTTTTGAAGGGTTAGTGTTGGCACAAGAGGTGTACAGAAGAAATAGTAATAAATA
CAGAATTTGGAGAGGCCGGTGTCTTTGTTAATTCCTGTTTATATACACAAATATCTCTTGTTTTGTCACAATTGTCAGGCAGGTAGGAAGAATCC
TTTTGTTTATGAGCGACCTTAATTCTTATCTCACTACTTGGGGATTGCTTGCTCGGTTTGGGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E290170] SGN-U568380 Tomato 200607 Build 2 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T103618 [Download] [View] Facility Assigned ID: TMEAQ42TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.951 Expected Error Rate: 0.0144 Quality Trim Threshold: 12.5