EST details — SGN-E290242
| Search information |
| Request: 290242 | Match: SGN-E290242 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C87589 | Clone name: cLET-5-D3 |
| ||
| Library Name: cLET | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: leaf
Development Stage: 4-6 weeks
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
No additional reads found.[Show information hierarchy]
| Sequence |
| Sequence Id: SGN-E290242 | Length: 171 bp (865 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E290242 [] (trimmed)
TTACATTACAACTAAAAGAAAATGGAGTCAAAGTTTGCTCACATTATTGTTTTCTTTCTTCTTGCAACTTCCTTTGAAACTCTCATGGCACGAAA
AGAAATTGATAGACTAGAAGTCACAGAACTTCTAAAGGAATTTGAATCCGACTTGATGTGCAAAGGAAAATTAAGT
AGAAATTGATAGACTAGAAGTCACAGAACTTCTAAAGGAATTTGAATCCGACTTGATGTGCAAAGGAAAATTAAGT
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E290242] | SGN-U578980 | Tomato 200607 | Build 2 | 13 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T103690 [Download] [View] | Facility Assigned ID: TMEAS14TH |
| Submitter: Koni | Sequencing Facility: TIGR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.944 | Expected Error Rate: 0.0146 | Quality Trim Threshold: 12.5 |
Working
