Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E290279

Search information 
Request: 290279Match: SGN-E290279
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C87577Clone name: cLET-5-D12
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C181965 is on microarray TOM1: SGN-S1-1-6.2.10.12
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C181965 [TUS-38-F11] Trace: SGN-T194448 EST: SGN-E393122 Direction: 5' Facility: INRA
Clone: SGN-C181965 [TUS-38-F11] Trace: SGN-T194696 EST: SGN-E393370 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E290279Length: 528 bp (632 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E290279 [] (trimmed) GACAAGGTTGGTCTTCTTTCTTTTCCACAAAGAGACGATGGATTTGAGATGTCAAAGCCTTACAGTAGCAAGACAGCAGCAATTATCGATACTGA
AGTAAGAGAATGGGTGTCCAAGGCATATGACCGCACTGTGCAACTTATAGAGAAGCATAAAGAACATGTAGCACAGATTGCAGAGTTACTACTTG
AGAAAGAGGTTCTTCATCAAGAAGATTTGGTTCGAGTATTGGGTGAACGCCCATTCAAGAGCCACGAGCCCACAAACTATGATATATTCAAGCAA
GGATTCGAAGAAGAGAACAAAGAAACCAAAGTTAACCCCGAAAATAAGACTGTAGAAGATAACGGATCACCACCGGTCGTACCTGAGGTTGTTCC
ATTGTAGTTGTTGGTTGGTGCTTTGTAAATGATAAAGTGGTGTAGTTGCTGTTTGGATATTCACTTTCACTTCTTATTAGAAAAGTTTTAGAAGA
TAGAAAAAAACACATTTTGATATTAATAACACAGAAATCCATTTCTGATTTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E290279] SGN-U571976 Tomato 200607 Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T103727 [Download] [View] Facility Assigned ID: TMEAT18TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0003 Quality Trim Threshold: 14.5