EST details — SGN-E290449

Search information 
Request: 290449Match: SGN-E290449
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C77243Clone name: cLES-20-F8
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C179286 is on microarray TOM1: SGN-S1-1-5.2.2.16
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179286 [TUS-31-F20] Trace: SGN-T185644 EST: SGN-E373506 Direction: 3' Facility: INRA
Clone: SGN-C179286 [TUS-31-F20] Trace: SGN-T185645 EST: SGN-E373507 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E290449Length: 569 bp (870 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E290449 [] (trimmed) TTCACACTTAAGGCTTGGAATGCTCAAAAGGCTGGAGCTGCTGCTATTCTTGTTGCTGATGATCGCAATGAACCTTTGATTACCATGGACACTCC
TGAGGAAGAGGATGCAAAGGCAGATTATCTGCAAAATATAACTATTCCGTCAGCTCTAATTAGTCAATCGCTTGGGGATAGCATCAAGAAGCAAC
TATCTAAAGGGGAGATGGTTAACATAAACCTGGATTGGAGAGAGGCTCTTCCGCATCCTGATGAAAGAGTTGAGTACGAGTTTTGGACCAACAGT
AATGATGAGTGTGGTCCTAAGTGTGAAAGCCAGAGAGAGTTTGTCAAAAACTTCAAAGGGGCTGCCCAGATACTTGAGCAGAAGGGGTATACACA
ATTCAGTCCCCATTACATAACTTGGTATTGTCCTGAGGCATTTATTTTGAGCAAGCAATGCAAGTCTCAGTGCATCAACCATGGGAGATACTGTG
CTCCAGATCCTGAGCAAGACTTCAGCAAAGGTTATGATGGGAAGGATGTTGTTTTACAAAATCTGCGCCAAGCTTGCTTTTATAAAGTTGCCAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E290449] SGN-U574304 Tomato 200607 Build 2 32 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T102128 [Download] [View] Facility Assigned ID: TPSDB28TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0053 Quality Trim Threshold: 14.5