EST details — SGN-E290492

Search information 
Request: 290492Match: SGN-E290492
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C77200Clone name: cLES-20-E11
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C179266 is on microarray TOM1: SGN-S1-1-1.1.2.16
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179266 [TUS-31-E24] Trace: SGN-T185291 EST: SGN-E373849 Direction: 3' Facility: INRA
Clone: SGN-C179266 [TUS-31-E24] Trace: SGN-T185292 EST: SGN-E373850 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E290492Length: 358 bp (837 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E290492 [] (trimmed) CTCGAGTTCATTTGCTATTCAGCGGGGCCTCTACCCGAGGAACTACTACCTCAAGTGAAGTGTCCTGTTCTGGTGGCATGGGGTGACAAGGATCC
TTGGGAGCCAATAGAACTTGGTAGAGCCTATGGCAACTTTGATACAGTCGAAGATTTTGTCGTCCTCCCTAATGTTGGCCATTGTCCTCAGGACG
AGGCACCTCATCTTGTGAACCCACTGGTGGAATCATTTGTTGCCCGGCATGCCAACGTATGAGAGCTGAGTCGCGGTGAGCGTGTAGTCTTATTG
TTTACATCAGAATACACGTATGGTTTCGCGTCGCTAGTCGAAAAAGACAGAAGAATGTACATGGGAGAACAAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E290492] SGN-U565638 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T102171 [Download] [View] Facility Assigned ID: TPSCY30TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.991 Expected Error Rate: 0.0009 Quality Trim Threshold: 12.5