Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E290622

Search information 
Request: 290622Match: SGN-E290622
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C77271Clone name: cLES-20-H14
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C179295 is on microarray TOM1: SGN-S1-1-4.3.2.8
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179295 [TUS-31-G5] Trace: SGN-T185117 EST: SGN-E372660 Direction: 3' Facility: INRA
Clone: SGN-C179295 [TUS-31-G5] Trace: SGN-T185118 EST: SGN-E372661 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E290622Length: 569 bp (872 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E290622 [] (trimmed) AATTCATGTTCAAATTCGTCTCTTGAGAATTGAGAATTCAGAAATTTGTTTGATTTTGAAGATGACAACTGAACAACTACTTCTAAGTATCGATC
CTTTGGACCTCAAATTTCCATTTGAACTCAACAAGCCAGTTTCGACCGCTTTTCAACTCATCAATAAGACTGATAATCATGTTGCTTTCAAGGTA
AAGACGACCAATCCCAGAAAGTATACTGTTAGGCCGAACAGTGGAATTGTTCTCCCACGATCAAGGTCCAATGTTACAGTTACGATGCAACCTCA
AATGGAGTTACCTCCAGGTATGCAATGCAAAGACAAGTTTCTTGTACAGAGTGTGATTGTGGACCCTGGGTCTACAGCAAAAGATATTAACCCAG
ACATGTTCAACAAGTCCGGGGTAAATGATGTTGAGGAATGCAAACTAAAAGTTATTTATGTCTCACCACCGCGAAAACCATCACCAGTCCCTGAA
GATTCTGAGGAAGGAACTTCACCAACAGCTTCTGACAGTGATTTACAAGAAGACAGTGAGCCTCAGGACAACTCCATTAAGGCCAGAGATCTCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E290622] SGN-U572969 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T102301 [Download] [View] Facility Assigned ID: TPSDB43TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0023 Quality Trim Threshold: 14.5