EST details — SGN-E290886

Search information 
Request: 290886Match: SGN-E290886
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C79948Clone name: cLET-10-L3
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C182055 is on microarray TOM1: SGN-S1-1-4.2.10.9
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C182055 [TUS-38-J5] Trace: SGN-T194711 EST: SGN-E393385 Direction: 3' Facility: INRA
Clone: SGN-C182055 [TUS-38-J5] Trace: SGN-T199328 EST: SGN-E398002 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E290886Length: 632 bp (875 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E290886 [] (trimmed) TTCCAGGAACTCAGAAGTAAAATACGTGCATAAGAAGCAGTCTGGTGGTTCAGGACAGTTTGCTGATATCACAGTAAGGTTTGAACCCATGGAAG
CAGGTGGTGGATATGAATTCAAGAGTGAAATCAAGGGAGGTGCAGTGCCAAAAGAATATATCCCTGGTGTTATGAAGGGATTAGAAGAATGCATG
AGTAACGGAGTACTGGCAGGCTTTCCAGTTGTTGATGTTCGTGCTGTGCTAGTAGATGGATCTTACCATGATGTGGATTCAAGTGTTTTGGCATT
CCAGCTGGCTGCTCGGGGAGCTTTTAGGGAAGGGATGAGAAAAGCTGGTCCACAATTGCTAGAACCCATAATGAAGGTTGAAGTAGTTACACCAG
AAGAACATCTAGGGGATGTGATTGGTGACCTTAACTCAAGGAGAGGCCAGATCAACAGCTTTGGAGACAAGCCTGGAGGTCTCAAGGTGGTGGAT
TCTTTAGTTCCATTAGCAGAGATGTTCAATTACGTTAGTACCTTGCGAGGAATGACAAAGGGGCGTGCATCGTATGTTATGCAGTTAGCCAAATT
TGACGTTGTCCCTCAACACATTCAAAACCAGCTTGCCAAAAAGGAGGAAGCAGCTGCTGCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E290886] SGN-U579489 Tomato 200607 Build 2 24 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T105055 [Download] [View] Facility Assigned ID: TMEBM62TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0020 Quality Trim Threshold: 14.5