EST details — SGN-E291122

Search information 
Request: 291122Match: SGN-E291122
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C88465Clone name: cLET-8-F13
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C190766 [TUS-61-E4] Trace: SGN-T341671 EST: SGN-E540796 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C190766 [TUS-61-E4] Trace: SGN-T349319 EST: SGN-E548444 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E291122Length: 545 bp (730 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E291122 [] (trimmed) GGATGACCCAGCTAAGGGGGCAGCCAGTTTCACTGCCCAGGTCATCATCATGAACCATCCTGGCCAGATTGGAAATGGATATGCACCAGTGCTTG
ACTGCCACACTTCCCACATTGCTGTCAAGTTTGCTGAGATCTTGACCAAGATTGACAGGCGTTCAGGTAAGGAACTTGAGAAGGAGCCTAAGTTC
TTGAAGAATGGTGATGCTGGTATGGTTAAGATGATTCCCACCAAGCCCAGAAGAAGGGAAAGTAGAGTGCATTTGATGAGCACGGATGAAATAGT
TTTGTTTATTTGCATCAGTTTTTTTCATTTTTGTTTTGGACAGCATTTTGCCAGTTTTGGATATGGCTACAGAAGGTATTGTCATGGTTCTCTAG
CCTCTTTTTGAGGATAGTGGAGTAATTGAGCAATTATGTCGGGACCAAATTACTTGATGGGCAATGACATATAGCTCTGTTGGTTGTTCCTTTAC
CTGNGTTAAATCACTTTACACACAGTCTTGGTCACTGCTCAACTTATTTAAGTTTATGAAATTTTGAGTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E291122] SGN-U577204 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T104518 [Download] [View] Facility Assigned ID: TMEBE31TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0068 Quality Trim Threshold: 12.5