EST details — SGN-E291345

Search information 
Request: 291345Match: SGN-E291345
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C84724Clone name: cLET-2-B17
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C190618 [TUS-60-N24] Trace: SGN-T341417 EST: SGN-E540542 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C190618 [TUS-60-N24] Trace: SGN-T341419 EST: SGN-E540544 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E291345Length: 542 bp (766 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E291345 [] (trimmed) GATGTCCGGTCAACAGTCACAAACCAAGCTTCCATGTAAATACTAGTGTAACCTTGAAGAACAGCAATTGGAAGAGAAGTAGCTCAGGACAAAAA
AGTGGGATGCCAATGCCAAATATGGAAGAGAGCATGACCGAGGAAGAATTTGTCGAGTGGCTACAGAATGCTGTAGAAGCGGGTATGTTTGATGA
TTTTGATGGCAGCACGCCACAGAGCCCATCTACACCAGCTGGAAGTACCTCCAAGAGTAGTAGTAGTAGTACAAGCAACGGTAGTGGAAGTGGAA
ACAAGAGAAAGAAAAAGGGGAAGAAGCAATGGTAGTATGAAGCTCACTCTGATCCTGCCTCCTTGAATTATTCAAGGACTGAGACGGCCAGATGA
GAGCCAAAATTAGCTGATACTAGCCTGGAATTGACTTGACCCCATGATTTCTGTTAGACGCAGAATCGTCGTCTAAGCATTTTCTGGGTCAGTTT
AAAATAGATTGCCCAAAAGTTGACAAATAAATTGTAGTCTCACATTCTGGGTAAAATGTTCCTACCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E291345] SGN-U570348 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T102886 [Download] [View] Facility Assigned ID: TMEAG09TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0055 Quality Trim Threshold: 14.5