EST details — SGN-E291409

Search information 
Request: 291409Match: SGN-E291409
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C84927Clone name: cLET-2-L20
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E291409Length: 380 bp (808 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E291409 [] (trimmed) GTGGACTTGACTACTTGGGCAACCCAAGCTTGGTCCATGCACAGAGCATCTTGGCCATCTGGGCTTGCCAAGTTGTACTCATGGGAGCCGTTGAA
GGTTACCGTATTGCTGGTGGACCTATTGGTGAGGTTGTAGACCCACTCTACCCAGGTGGCAGCTTCTACCCATTAGGCCTTGCTGAAGACCCTGA
GGCATTTGCTGAGCTCAAGGTAAAGGAAATTAAAAACGGTAGACTTGCTATGTTCTCTATGATTGGATTCTTTGCTCAAGCCATTGTTACTGGAA
AGGGACCATTGGAGAACCTTGCTGATCACCTTGCAGACCCAGTAAACAACAGCGCCTGGTCTTACGCCACAGACTTTGTCCCCGGAAAATAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E291409] SGN-U579405 Tomato 200607 Build 2 97 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T102950 [Download] [View] Facility Assigned ID: TMEAH70TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.979 Expected Error Rate: 0.0204 Quality Trim Threshold: 12.5