EST details — SGN-E292057

Search information 
Request: 292057Match: SGN-E292057
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C82133Clone name: cLET-1-A17
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C82133 [cLET-1-A17] Trace: SGN-T102545 EST: SGN-E292271 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E292057Length: 513 bp (874 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E292057 [] (trimmed) GACTCTGTCGTACCTTCCTGATTTGTCCGACGAGCAATTGCTCAGCGAAATTGAGTACCTATTGAAAAATGGATGGGTTCCTTGCTTGGAATTCG
AGACTGAGCACGGATTTGTGTACCGTGAGAACCATAAGTCACCAGGATACTACGATGGCAGATACTGGACCATGTGGAAGTTGCCCATGTTCGGG
TGCACTGATGCAACCCAGGTCTTGGCTGAGGTGCAGGAGGCAAAGAAGGCTTACCCACAGGCATGGGTCCGTATCATCGGATTCGACAATGTTCG
TCAAGTGCAGTGCATCAGTTTCATCGCTTACAAGCCCGAAGGATACTAAGTTCTAGAAAAACTAATTGCCCTATGTTTATAGGGACAGTTTGTTT
GAATTCTCCTTTGGGTTTTCCCTTGAGAAATTGTATTCATTTTCCCTTGTTTTCCATCTTTTTATTCCGTGTATGATTAATTCGAATTTCAATCA
AGTTTACAAGAACTATATTAATGATATTTGTTTCTTTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E292057] SGN-U580869 Tomato 200607 Build 2 1124 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T102331 [Download] [View] Facility Assigned ID: TMEAA09THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.979 Expected Error Rate: 0.0065 Quality Trim Threshold: 12.5