EST details — SGN-E292076

Search information 
Request: 292076Match: SGN-E292076
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C82225Clone name: cLET-1-E5
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C179429 is on microarray TOM1: SGN-S1-1-6.4.2.17
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C82225 [cLET-1-E5] Trace: SGN-T102349 EST: SGN-E292075 Direction: 5' Facility: TIGR
Clone: SGN-C179429 [TUS-31-L19] Trace: SGN-T185506 EST: SGN-E373368 Direction: 3' Facility: INRA
Clone: SGN-C179429 [TUS-31-L19] Trace: SGN-T185507 EST: SGN-E373369 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E292076Length: 394 bp (553 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E292076 [] (trimmed) CATTCTTAAATTAGCGTGAATATTAATTAAGTTACATGATAGAGCAAGCATTAGGATTGTTATCACTGAAAATTTGAGGAGAATAATTAGCGTAG
TACTCCATGTTGTTGTTGTAGTACTTTTGAGCTAAATTATAATCCTTAATAATATATTCTTCTTTTTCTTCCTCCTTCTCTTCTTCTTCTTCTTT
CTCTTGAATAATATTATTTACGAGTGAAGCTTGTTTTCCGCTTCTCTTATTCACTTCTTTAGTTAACTTTTCTGGGTCGATATTGAAACCTTTTA
TAATTACTTGACTTTTTTCAATATCTGTCGTAACACATTCTACACCTTTGATTTTGCGGATTTGCTTCTGAAGAACTTGAGCACAAGCATCACAA
TGTCTCTCTCTCTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E292076] SGN-U563665 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T102350 [Download] [View] Facility Assigned ID: TMEAA27TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.913 Expected Error Rate: 0.0001 Quality Trim Threshold: 12.5