EST details — SGN-E292113

Search information 
Request: 292113Match: SGN-E292113
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C82334Clone name: cLET-1-K1
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C179508 is on microarray TOM1: SGN-S1-1-7.4.2.10
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C82334 [cLET-1-K1] Trace: SGN-T102388 EST: SGN-E292114 Direction: 3' Facility: TIGR
Clone: SGN-C179508 [TUS-31-P2] Trace: SGN-T185606 EST: SGN-E373468 Direction: 3' Facility: INRA
Clone: SGN-C179508 [TUS-31-P2] Trace: SGN-T185607 EST: SGN-E373469 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E292113Length: 454 bp (555 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E292113 [] (trimmed) TTCAACAGAAAATTATGCCTGGTTTATGGAAGGATCTTCCTGGTAAGATCCATCACAAAGTGTCTGAAAATTGGATCAGCGCTACCCTCTTGCTT
GGTCCACTCGTCGGAACCTACTCGTATGTGCAGAACTTCCTGGAAAAGGAGAAGTTAGAACACAGATACTAAAACTGTTTCTTCATCAGTCTGTT
GGATACATCTCTATTCCATTTTGCAGTTTTCAACAGGAAATAAGCTGCCATTGTTGCATTTTTTTTTTTGGAACTTGTTATTTTGAAGATAATTT
ACTTGTATGGCGCCCTATAAATAACAACTAAATTCTCTGTTGGGGTCTTTTGATTGTCTTGTGCATCCTAAATCTTATTCAGAAATAGAGTTTTG
AAAATAATTTGTAATACATTTCATTGACTTGCTGTTGAAGTCCCATTGTGATTGCACAATGAACAATTTTTATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E292113] SGN-U567580 Tomato 200607 Build 2 16 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T102387 [Download] [View] Facility Assigned ID: TMEAA61TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.946 Expected Error Rate: 0.0008 Quality Trim Threshold: 14.5