EST details — SGN-E292267

Search information 
Request: 292267Match: SGN-E292267
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C82459Clone name: cLET-1-P24
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C179595 is on microarray TOM1: SGN-S1-1-8.3.1.18
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179595 [TUS-32-C17] Trace: SGN-T185808 EST: SGN-E373145 Direction: 3' Facility: INRA
Clone: SGN-C179595 [TUS-32-C17] Trace: SGN-T185809 EST: SGN-E373146 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E292267Length: 282 bp (909 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E292267 [] (trimmed) GGAAAGGTCGCGTATTTTGTTGGCATTCAGATAGAAGATACTACCGAGGCTCGGGAGAAACAAGGACTGAATCCGGAAATGAGGCATCGCAGTGT
TGTAGCTGCTGTAAAGGTGGCTGTGAGAGGGTGGTCAATGGGTGCAAGTACCTCCTAGTTCATGAAGAAATTTGTGTTTTGCTTTTTTTGGTTCT
GATAAACAAACTGGACTCTGCTGATAAAAATGTACTCTTGTTAGCTCATTGGTACCAGAAAAAATAAAAAACATTAACAAGTATGTTATGGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E292267] SGN-U568980 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T102541 [Download] [View] Facility Assigned ID: TMEAD96TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.949 Expected Error Rate: 0.0078 Quality Trim Threshold: 12.5