Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E292271

Search information 
Request: 292271Match: SGN-E292271
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C82133Clone name: cLET-1-A17
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C82133 [cLET-1-A17] Trace: SGN-T102331 EST: SGN-E292057 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E292271Length: 514 bp (601 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E292271 [] (trimmed) AGTAAAGAAACAAATATCATTAATATAGTTCTTGTAAACTTGATTGAAATTCGAATTAATCATACACGGAATAAAAAGATGGAAAACAAGGGAAA
ATGAATACAATTTCTCAAGGGAAAACCCAAAGGAGAATTCAAACAAACTGTCCCTATAAACATAGGGCAATTAGTTTTTCTAGAACTTAGTATCC
TTCGGGCTTGTAAGCGATGAAACTGATGCACTGCACTTGACGAACATTGTCGAATCCGATGATACGGACCCATGCCTGTGGGTAAGCCTTCTTTG
CCTCCTGCACCTCAGCCAAGACCTGGGTTGCATCAGTGCACCCGAACATGGGCAACTTCCACATGGTCCAGTATCTGCCATCGTAGTATCCTGGT
GACTTATGGTTCTCACGGTACACAAATCCGTGCTCAGTCTCGAATTCCAAGCAAGGAACCCATCCATTTTTCAATAGGTACTCAATTTCGCTGAG
CAATTGCTCGTCGGACAAATCAGGAAGGTACGACAGAGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E292271] SGN-U580869 Tomato 200607 Build 2 1124 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T102545 [Download] [View] Facility Assigned ID: TMEAA09TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0028 Quality Trim Threshold: 14.5