EST details — SGN-E292446

Search information 
Request: 292446Match: SGN-E292446
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C82358Clone name: cLET-1-L12
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C179531 is on microarray TOM1: SGN-S1-1-8.1.1.10
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179531 [TUS-32-A1] Trace: SGN-T1535 EST: SGN-E378289 Direction: 5' Facility: Giov. Lab
Clone: SGN-C179531 [TUS-32-A1] Trace: SGN-T185705 EST: SGN-E373042 Direction: 5' Facility: INRA
Clone: SGN-C179531 [TUS-32-A1] Trace: SGN-T185791 EST: SGN-E373128 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E292446Length: 475 bp (908 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E292446 [] (trimmed) GACTCTCAGCAGATCGAGCAAAAATCAAAGGGGATGGCGCCGCCGAACACAGGATTAGCAGTGGGATTGAACAAAGGACACATTGTAACCAAGAA
GGAGTTAGCTCCACGCCCTTCTGACAGAAAAGGGAAAACCAGCAAAAGAATCCACTTCGTCAGGAGCCTCATCAGAGAAGTTGCTGGATTTGCTC
CATATGAGAAGAGGATTACTGAGCTTCTTAAAGTTGGTAAGGACAAGCGTGCATTGAAGGTAGCCAAGAGGAAGTTGGGTACCCACAACAGGGCA
AAGAAGAAGAGAGAGGAGATGTCCAGCGTTCTCCGTAAGATGAAGGCAACCGGTGGTGGTGAAAAGAAGAAGAGAAGTCTCTATCCTTATTTTGA
CAATTGAGGAACTGAGTTTATTAGTTAATACATGATCTTTTTGAGTTAGCTATAAAATTCTCTAAACTTTGACACAATTATGGCTTTGAATTTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E292446] SGN-U580851 Tomato 200607 Build 2 70 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T102720 [Download] [View] Facility Assigned ID: TMEAD66TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.953 Expected Error Rate: 0.0119 Quality Trim Threshold: 12.5