EST details — SGN-E292487

Search information 
Request: 292487Match: SGN-E292487
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C81509Clone name: cLET-16-O16
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C182207 is on microarray TOM1: SGN-S1-1-4.4.10.14
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C182207 [TUS-38-P13] Trace: SGN-T194499 EST: SGN-E393173 Direction: 5' Facility: INRA
Clone: SGN-C182207 [TUS-38-P13] Trace: SGN-T194738 EST: SGN-E393412 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E292487Length: 452 bp (929 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E292487 [] (trimmed) GTTATTATTTCCCTCCAACAAGATCACCACCACCCAGAGACTCGTCGTAAGGGCGGCCGCAGAAGAGGCTGCCGCACCAGCCGCGGCCGCTACTG
CTGAACCAGCCGTTGAAACCAAAGCTGCTAAGCCACCTCCAATTGGACCCAAGAGGGGATCCAAGGTGAGAGTTCTTAGGAAGGAATCTTACTGG
TACAAGGGCACCGGTTCAGTTGTAGCTGTTGATCAGGATCCAAAAACTCGTTACCCAGTTGTTGTACGATTTAACAAAGTGAATTATGCTAATGT
TTCAACCAACAACTATGCATTGGATGAAATTGAAGAAGTGTGAAATGAGAACGTATGCCCTCAATTGGAATAAGTATATTATTTGTAGAATGCAA
GGCCCTTTGTTTCTTTCATGTTTATTCTCTAGGTATATACAGGCTTTGAATGTGAATGAGTGTCTTATTGTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E292487] SGN-U578899 Tomato 200607 Build 2 32 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T106620 [Download] [View] Facility Assigned ID: TMECJ92TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.989 Expected Error Rate: 0.0062 Quality Trim Threshold: 12.5