EST details — SGN-E292703

Search information 
Request: 292703Match: SGN-E292703
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C80092Clone name: cLET-11-D3
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C179630 is on microarray TOM1: SGN-S1-1-5.1.1.11
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179630 [TUS-32-E4] Trace: SGN-T185894 EST: SGN-E372399 Direction: 3' Facility: INRA
Clone: SGN-C179630 [TUS-32-E4] Trace: SGN-T185895 EST: SGN-E372400 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E292703Length: 395 bp (815 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E292703 [] (trimmed) ATAAAAGCAAAATGGAGGGAAAGAATATGCTCAAGTTATCTCATGTGCTTGCTTTCTTGCTTCTTGCATCACTTTTTCAATCACTGATGGCAAGA
GATTTGATCAGTGATGGCATAGAAGTAGTGAAATTTCCAGTGGAAGATGATGGAGAATTTGTATTTTGCCCAGGTAAGCTATCATGGCCTGAACT
TGTTGGGAAATCAGCAGGATATGCAAAAGAAGTAATTCAAAAGGAAAATCCCATAGTTCATGATGTTAGGCTTCTATTTCCTGGTATGATTAGGC
CACTTAATTATGTTTGTGGCAGAGTTTTTCTGGTTGTTAACTTTAAACGCATTGTTCGAGTTACTCCCTCTATGGGTTAGTAACATTATTCTCAT
TATTATGTTATTATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E292703] SGN-U584916 Tomato 200607 Build 2 37 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T105166 [Download] [View] Facility Assigned ID: TMEBQ14TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.917 Expected Error Rate: 0.0025 Quality Trim Threshold: 12.5