EST details — SGN-E292807

Search information 
Request: 292807Match: SGN-E292807
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C80204Clone name: cLET-11-I3
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C179682 is on microarray TOM1: SGN-S1-1-1.3.1.11
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E292807Length: 481 bp (890 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E292807 [] (trimmed) GAAGAATCAAGAATCAAGGTGCTATGAACCAGGCAGTACAGAAAAACACTCTGTACGTAGGAGGATTAGCAGAGGAGGTGAATGAGGCAATACTA
CATGCTGCGTTCATACCATTTGGGGATATTAAGGATGTGAAGACCCCATTAGATCATGCCACTCAAAAGCATCGATCTTTTGGGTTTGTGACCTT
CCTTGAAAGAGAAGATGCTTCCGCCGCCATGGATAATATGGATGGTGCTGAGCTTTATGGACGTGTACTTACTGTTAATTATGCTCTTCCTGAGA
AGATTAAGGGTGGTGAACAGGGTTGGGCTGCTCAGCCAATTTGGGCGGATGCTGACACATGGTTTGAGAGGCAACAGCAAGAAGAGGAAATGAAG
CGCCTTCAAGAAGAGCAGAAGGCTGCAATGCANGTAGCGGAAGACTTGCATAGAAAAAAGATGGCTGAGGAAAGAGAAGGTGAAAAGGATGAAGA
CCCTAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E292807] SGN-U566917 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T105270 [Download] [View] Facility Assigned ID: TMEBO50TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0205 Quality Trim Threshold: 14.5