EST details — SGN-E292861

Search information 
Request: 292861Match: SGN-E292861
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C80283Clone name: cLET-11-M18
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C179713 is on microarray TOM1: SGN-S1-1-2.4.1.15
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179713 [TUS-32-H15] Trace: SGN-T186066 EST: SGN-E372913 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E292861Length: 393 bp (769 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E292861 [] (trimmed) GAAAATGAATTCAGTTGCAGCTATGGCTATGGTGTTTATGATCCTTCTATCGGCCAACATCGACACAGTTGGCGTCGCTGCTCAAGGCGTCAATT
GCTATGATAACTGCAACACCGGATGCGCCGGTCTCCCATCCAAGCAATATATCAAATGTGATAAGAAGTGCCACAAAAGATGTGGAGATGATGAC
AAAATTGATGGAAACGTTGGTTGAAAGTGATGAAATTTACTAGCAAGCTATTATTATATGGAGTTCCATAAATTTACTTCTCTCTTCGATAATAA
ACTTTACTTGTACTATGACTTTTTACTATAAGATGCATTGTATGATGATGAAACTATGTACTACTATTTGATATTATAATTGTTAATTCAATAAA
CAAAATTAGTCGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E292861] SGN-U579387 Tomato 200607 Build 2 57 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T105324 [Download] [View] Facility Assigned ID: TMEBP81TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.953 Expected Error Rate: 0.0095 Quality Trim Threshold: 12.5