EST details — SGN-E292929

Search information 
Request: 292929Match: SGN-E292929
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C80177Clone name: cLET-11-H20
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C179671 is on microarray TOM1: SGN-S1-1-4.2.1.19
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179671 [TUS-32-F21] Trace: SGN-T186144 EST: SGN-E372991 Direction: 3' Facility: INRA
Clone: SGN-C179671 [TUS-32-F21] Trace: SGN-T186145 EST: SGN-E372992 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E292929Length: 537 bp (900 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E292929 [] (trimmed) TGGAGGTGTTAAGAAGAGTAAGAAGAAAGCGGTGGCGTCGAGTTTTGAGGAATTGGGGTTGACGGAAGAGGTTATGGGGGCTTTAGGTGAAATGG
GTATTTCGGAACCGACTGAGATTCAGTCGATTGGTATACCTGCTGTGATTGAAGGGAAAAGTGTGGTATTGGGTTCACATACGGGTTCTGGGAAG
ACTCTTGCTTATATGTTGCCTATTGTTCAGTTGTTGAGGCGAGATGAGGAATTGGATGGTATGCTCATGAAGCCTAGGCGCCCCCGAGCTGTTGT
GTTGTGCCCTACTAGGGAGCTCTGTGAGCAGGTTTTTCGTGTGGCAAAATCTATCAGTCATCATGCTCGATTTAGATCTACCATGGTTAGTGGTG
GCGGACGTCTGAGACCTCAAGAAGATTGTTTGGCAAGCCCAATTGACATGATTGTGGGGACTCCAGGCAGGGTTCTACAACATATTGAAGAGGGA
AATATGGTTTATGGTGACATCAGATACTTGGTCTTGGATGAGGCTGATACCATGTTTGATCG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E292929] SGN-U562627 Tomato 200607 Build 2 16 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T105392 [Download] [View] Facility Assigned ID: TMEBR46TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0118 Quality Trim Threshold: 14.5