Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E292967

Search information 
Request: 292967Match: SGN-E292967
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C80494Clone name: cLET-12-G5
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C190840 [TUS-61-H6] Trace: SGN-T341801 EST: SGN-E540926 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E292967Length: 628 bp (849 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E292967 [] (trimmed) GTTGCAGCTAACGGTTCTGTGGAGGCATCAACAACAATGGGGGGTTTCAATCCAGCAATCGAATTGAGTATTCTTCTTCTCCTCCCATTCCTCTC
ATCTCCTTCTTCTCTCTCTCTCAATCTACCCAATACAACAGTATACGAAATCCTCACTAAATTCAACCTTCCTCCAGGGCTTTTACCTAGTTCTG
TAAAATCTTACTCTCTTTCCGATGATGGAACATTTGAAGTTTTACTGGACAAGCCTTGTTATGTGGAGTTTGAGTATTTGGTTTATTATGATGAG
AAGGTTACTGGGAAGCTGAGTCTTGGGTCGATTACTGATTTAGAAGGAATTCAAGTTAAGAGATTCTTGTTGTGGCTAAACGTGAATGAGATCCG
TGTGGATTTGCCATCGTCTGGGAGTATTTACTTTCAAGTTGGGTTCATTAACAAGAAGCTTGATATCAATCAGTTTGAAACTCCTCGTTCTTGCC
GGGATAATGGTTTGGTTATGTGTGGAGGACCATCTCTGAGACAGCTTCCGGCTCCTGTCAATAATATGGAAATGTTTGTTACAGAGTAGCCTGGG
ACCTAATATGCATATCAAGCCAAAAGTTGGGCAGATGGAGATATCATATACTTCATCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E292967] SGN-U563018 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T105430 [Download] [View] Facility Assigned ID: TMEBS39TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0074 Quality Trim Threshold: 14.5