EST details — SGN-E293343

Search information 
Request: 293343Match: SGN-E293343
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C81846Clone name: cLET-18-I17
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C181860 is on microarray TOM1: SGN-S1-1-7.2.10.7
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C181860 [TUS-38-B2] Trace: SGN-T187750 EST: SGN-E374480 Direction: 5' Facility: INRA
Clone: SGN-C181860 [TUS-38-B2] Trace: SGN-T187816 EST: SGN-E374546 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E293343Length: 509 bp (925 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E293343 [] (trimmed) CCGGAAGTGATTTAAAGAATTTATGTGTCACAGCTGCTCATTGCCCAATTAGAGAAATATTGGAGAAAGAGAAAAAGGAAAAAGCATTGGCAGTT
TCAGATAGCAGGCCAGTCCCTGCATTGCATAGTAGTGTGGACGTTCGCCCCCTTAACAAGGATGATTTTAAATATGCACATGAACAGGTATGTGC
TAGTGTATCTTCAGAATCGGCAAACATGAATGAGTTACTCCAGTGGAATGAATTGTATGGAGAAGGTGGATCAAGGAAGAAGAAATCTCTCAGTT
ACTTCATGTAGAGACATGTGAAGTGTATAGTGTTGCTTTATTTATTTACCCAAGTTGGTAGGGACGGGTCCTGCATGCATGGAAATCCATTTCAG
GTTCCCTGGAGTCCAAACCCCCAACCGCGGAAAACTGTGTATCATAGTTAGTTAATAGTTATGAAATATCTATCTATCCGAAGCTTGTCTTCCAA
TTTTCACCTTATTGGATCTCCTCTGTATATACAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E293343] SGN-U567311 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T107168 [Download] [View] Facility Assigned ID: TMECQ57TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0023 Quality Trim Threshold: 12.5