EST details — SGN-E293397

Search information 
Request: 293397Match: SGN-E293397
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C81908Clone name: cLET-18-N7
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C190938 [TUS-61-L8] Trace: SGN-T341966 EST: SGN-E541091 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C190938 [TUS-61-L8] Trace: SGN-T341969 EST: SGN-E541094 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E293397Length: 531 bp (840 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E293397 [] (trimmed) CAGGTTTCTCTCTCAATAGATCCCTCATTCTAAAAGCTCTTTTCAGGGATCATCATCAAGGAAGCGTGATGGGGCTCACATTCACCAAGCTCTTC
AGTCGGCTTTTCGCCAAGAAGGAAATGCGCATTCTAATGGTTGGTCTTGATGCAGCTGGTAAGACCACCATATTGTACAAGTTGAAGCTGGGAGA
GATCGTGACTACTATTCCTACCATTGGTTTCAATGTGGAGACTGTTGAGTACAAGAACATCAGCTTCACTGTTTGGGATGTCGGAGGTCAGGACA
AGATCCGTCCATTGTGGAGGCACTACTTCCAGAACACTCAGGGTCTCATTTTTGTGGTTGATAGCAATGATAGAGACCGTGTTGTAGAAGCAAGA
GATGAATTGCATAGGATGTTGAACGAGGATGAACTTCGGGATGCTGGGCTTCTAGTATTTGCTAACAAACAAGATCTTCCTAACGCAATGAATGC
TGCTGAAATAACTGATAAGCTTGGACTGCACTCCCTCAGGCAGCGTTACTGGTACA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E293397] SGN-U580248 Tomato 200607 Build 2 52 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T107222 [Download] [View] Facility Assigned ID: TMECS76TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0078 Quality Trim Threshold: 14.5