EST details — SGN-E293401

Search information 
Request: 293401Match: SGN-E293401
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C81915Clone name: cLET-18-P1
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C181866 is on microarray TOM1: SGN-S1-1-1.2.10.7
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E293401Length: 457 bp (835 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E293401 [] (trimmed) CAAACACCAATCAGTTTCCCTTCAGCAAAACATGTTAACTACAAAGGAAGAAACTAAAAAGGAGAGTAATGAAGCTGTAAAATAAAACAATATGA
AGGAGCTAAAAGAACAGCCTTCGAGTAGGTGTCCGTGAGGTTGTTGAAGGTGTGTTTGATGATCTCAGGGTAACAGGTGATGCCATGTTTTCTTT
GATTCCTGCCCCCTTCTCGATTAGCTTTGCTCCCCGTGGATCAGATAGAAGTGTCTTCTGAAACGACTGGGTGAAACCAGTTGCAATTATTGTCA
CGTGTATTTCACCATTGTAACGCTCATCAACAACAGCACCAAATATGATGTTAGCAGAGGGATCAGCTAGACTGGTAACAACCTGGGACACCCTA
TTCACTTCTTGCAAAGCTATGTCTTTTCCTCCTGTAATGTTATATACTACCCCAGTTGCAGATTGAATTGACGACCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E293401] SGN-U566680 Tomato 200607 Build 2 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T107226 [Download] [View] Facility Assigned ID: TMECS85TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.978 Expected Error Rate: 0.0093 Quality Trim Threshold: 14.5