EST details — SGN-E293476

Search information 
Request: 293476Match: SGN-E293476
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C81327Clone name: cLET-15-L23
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C81327 [cLET-15-L23] Trace: SGN-T106428 EST: SGN-E293477 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E293476Length: 350 bp (953 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E293476 [] (trimmed) GTTTAATGAAATGTTCAACAGTGATAATGGAACGTTTTCTTCTTCTTCTTCATCATCTTCTTCTTGGACTGGAACTCCTTCAATGTGCTCTACTA
CATCATCTACATCTTCAAGTGAGACTTTTTTAACCTTTCCCAACAAGAGAAGTTCAGGTGAAATGAAGTCGGGTAGTAGTGTAAGAGGCGATTCT
TGCCAATTCCAACGATTTTGTGTAGGGGCAGGTGGAACTTCTGGAAAATGCAATGAAAGAGAACGAAGATGGAGGAAAAATTCCAAGAGTGGACG
GAAGCATTAGGAGGAGAGATGCCAAAATGCAAAAGGTTCTATCATAGTTCAACAATTATTTTACC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E293476] SGN-U572726 Tomato 200607 Build 2 35 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T106427 [Download] [View] Facility Assigned ID: TMECG72TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.951 Expected Error Rate: 0.0139 Quality Trim Threshold: 14.5