EST details — SGN-E293541

Search information 
Request: 293541Match: SGN-E293541
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C81235Clone name: cLET-15-D13
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C81235 [cLET-15-D13] Trace: SGN-T106493 EST: SGN-E293542 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E293541Length: 550 bp (898 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E293541 [] (trimmed) TTTTTGTACATTCAAGAGTTTCTCATTCTACTTCTATAATGGCTACTTCTACCATGGCTCTTTCTTCCTCTACATTTGCCGGAAAGGCGGTTAAA
CTCTCCCCATCTTCTTCTGAAATCACCGGAAATGGGAGAGTCACCATGAGGAAAACTGCTACCAAGGCCAAGCCAGCCTCCTCTGGTAGCCCATG
GTATGGTCCTGACCGTGTTAAGTACTTGGGACCATTCTCTGGGGAATCCCCAAGCTACTTGACCGGTGAGTTTCCTGGTGATTACGGATGGGACA
CTGCTGGACTTTCAGCTGACCCTGAAACATTCGCTAAGAACCGTGAGTTGGAGGTTATTCATTGTAGATGGGCCATGCTTGGTGCTCTTGGATGT
GTATTCCCCGAGCTTTTGGCCCGTAATGGTGTTAAGTTCGGTGAAGCTGTATGGTTCAAGGCTGGATCACAAATTTTCAGCGAGGGTGGACTTGA
CTACTTGGGAAACCCAAGCTTGGTCCATGCACAAAGCATTTTGGCTATCTGGGCTTGCCAAGTTGTGTTGATGGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E293541] SGN-U579181 Tomato 200607 Build 2 140 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T106492 [Download] [View] Facility Assigned ID: TMECG19TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.977 Expected Error Rate: 0.0120 Quality Trim Threshold: 14.5