Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E293761

Search information 
Request: 293761Match: SGN-E293761
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C82768Clone name: cLET-21-H14
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C190978 [TUS-61-M24] Trace: SGN-T342035 EST: SGN-E541160 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C190978 [TUS-61-M24] Trace: SGN-T349379 EST: SGN-E548504 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E293761Length: 466 bp (889 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E293761 [] (trimmed) TTTGTGAATTCTAAATTCTGATCAGAACCCTAATTGAAACAATCGCTAAATCTTCAAATAATCACTTTTCTCTTTCCCAATTTTGATCAATTACA
GCTATGGCGACCAGTGGAAACAAGAATATGAACGCCAAATTGGTGCTCCTTGGGGATGTTGGAGCTGGAAAATCTAGTCTAGTTCTGCGTTTTGT
TAAAGGACAATTTATTGAATTTCAGGAATCAACCATAGGTGCTGCATTTTTCTCTCAAACAGTAGCAGTAAATGATGCAACTGTAAAATTTGAAA
TATGGGATACAGCAGGCCAAGAGAGATACCACAGTCTAGCTCCAATGTATTACAGAGGTGCTGCAGCTGCTATTATTGTTTATGATATAACAAAT
CAAGCATCATTTGATAGAGCAAAAAAATGGGTTCAGGAACTTCAAGCACAAGGTAATCCGAATATGGTGATGGCACTAGCCGGAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E293761] SGN-U565736 Tomato 200607 Build 2 30 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T107883 [Download] [View] Facility Assigned ID: TMEDF43TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.952 Expected Error Rate: 0.0078 Quality Trim Threshold: 14.5