EST details — SGN-E294140

Search information 
Request: 294140Match: SGN-E294140
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C80896Clone name: cLET-13-L15
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C179818 is on microarray TOM1: SGN-S1-1-1.4.1.20
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179818 [TUS-32-L24] Trace: SGN-T186260 EST: SGN-E372779 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E294140Length: 561 bp (859 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E294140 [] (trimmed) TTCTTTCTCAAAATTTTCTAAATTACAATAGTTCACCGTCGATCCTTTCTCGGTCAATTTTATATTCTGGTGACGATGTCGACGGCGAGAGCCGG
TAATGACGATAGTTCTAATGGTGTAGATACGACTCCGTTGCTTACCGATCAGGTTTTTAGGAGCCGACGGTTGGCGCGCCGGGCCCCGACCCTAA
GAGGAGCGGCTCGATTTCTCCGGCGAGCAAGTAACCACCGACTGATGCGGGAGCCGTCAAGGCGCGTGAGGGAAGCTGCAGCTGAGCACATAGAG
GAACGACAAAGCGATTGGGCATATTCCAAACCTATAGTGATATTGGATCTTATCTGGAACTTAGCTTTTGTGATTGTCTCAGTTTCTGTGTTGAT
TCTGAGCCATGATGAGTTACCTTCTATGCCTTTGAGGCTTTGGATTGTTGGATATGCTTTACAGTGTTTGCTTCACATGGTTTGTGTTTGCGTTG
AGTATAGACGCCGAATTCAGCTTAGCGATTCATCTCCAATTTTGAATTCCGAGCAGAGAAACGCTGCTGGAGGTTGGAACAGTTCG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E294140] SGN-U582129 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T105983 [Download] [View] Facility Assigned ID: TMEBY68TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.982 Expected Error Rate: 0.0116 Quality Trim Threshold: 14.5