EST details — SGN-E294141

Search information 
Request: 294141Match: SGN-E294141
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C80898Clone name: cLET-13-L17
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C179819 is on microarray TOM1: SGN-S1-1-8.1.1.13
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179819 [TUS-32-M1] Trace: SGN-T185768 EST: SGN-E373105 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E294141Length: 655 bp (859 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E294141 [] (trimmed) TAGAATTGCCGTGCCGATACCAAATTTATGGCTGTCAAGATATATTCACTTATCATACTAGGCTTCGTCATGAGCAGAACTGCAGATTTCGACCA
TACAATTGCCCATATGCAGGATCTGAATGCGCTGTTACCGGTGATATTCAGTACCTCGTTGCACACCTAAAAGATGATCACAAAGTTGATATGCA
TGATGGCTGTACCTTCAATCATCGTTATGTCAAATCTAATCCTCAAGAAGTTGAGAATGCTACATGGATGTTGACGGTTTTTAACTGTTTCGGTC
ACCAGTTCTGCCTGCACTTTGAGGCTTTCAATCTTGGATTGGCACCGGTATACATGGCATTCCTTCGTTTTATGGGTGATGATGATGATGCGAAA
AGATTTAGCTATAGTCTTGAAGTAGGTGGATTTGGCAGAAAGTTAACATGGCAGGGAGTACCGAGGAGCATCCGTGATAGTCATAAAACTGTCCG
AGACAGTTTAGACGGGCTGATTATTCAAAGGAGCATGGCACTCTTCTTCTCTGGTGGTGACAGGAAGGAGCTGAAGCTAAAGGTAGCTGGGCGTA
TTTGGCGAGAGCCATTGTAAACTAGATATATGCATCTTCCTTCATCGTGGGGATGCCCTGAAAGTATAGTTAGTTATCGCTAAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E294141] SGN-U577526 Tomato 200607 Build 2 15 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T105984 [Download] [View] Facility Assigned ID: TMEBY69TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.982 Expected Error Rate: 0.0022 Quality Trim Threshold: 14.5