EST details — SGN-E294415

Search information 
Request: 294415Match: SGN-E294415
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C81079Clone name: cLET-14-G22
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E294415Length: 271 bp (852 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E294415 [] (trimmed) GATACATCTCTATTCCATTTTGCAGTTTTCAACAGGAAATAAGCTGCCATTGTTGCATTTTTTTTTTGGAACTTGTTATTTTGAAGATAATTTAC
TTGTATGGCGCCCTATAAATAACAACTAAATTCTCTGTTGGGGTCTTTTGATTGTCTTGTGCATCCTAAATCTTATTCAGAAATAGAGTTTTGAA
AATAATTTGTAATACATTTCATTGACTTGCTGTTGAAGTCCCATTGTGATTGCACAATGAACAATTTTTATTTNAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E294415] SGN-U567580 Tomato 200607 Build 2 16 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T106258 [Download] [View] Facility Assigned ID: TMECB47TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.903 Expected Error Rate: 0.0080 Quality Trim Threshold: 12.5