EST details — SGN-E294438

Search information 
Request: 294438Match: SGN-E294438
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C81199Clone name: cLET-14-O20
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C190884 [TUS-61-J2] Trace: SGN-T341876 EST: SGN-E541001 Direction: 5' Facility: INRA (MWG)
Clone: SGN-C190884 [TUS-61-J2] Trace: SGN-T349352 EST: SGN-E548477 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E294438Length: 225 bp (870 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E294438 [] (trimmed) AAGGGTCCTGCTTGGGCGTCGTTAATTATAATACTTCAATATGAGTTGCGCGGAAAATGCAACACAGACCATTTCAGTCGGACCATGGGGAGGTG
AAAATGGATTGCACTGGGATGATGGAGTTTATTCCACCATAACGAAACTGGAAATAGCTCACGGAACAGGAGTTGATTCCATTAAGGTTGAGTAC
GACAAAAATGGAACCTAAGTAATCTTCGAGAAGCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E294438] SGN-U595796 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T106281 [Download] [View] Facility Assigned ID: TMECB94TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.952 Expected Error Rate: 0.0247 Quality Trim Threshold: 14.5